Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0005397 | |||
Gene | RHOT1 | Organism | Human |
Genome Locus | chr17:30500849-30503232:+ | Build | hg19 |
Disease | Pancreatic Ductal Adenocarcinoma | ICD-10 | Malignant neoplasm of Pancreatic duct (C25.3) |
DBLink | Link to database | PMID | 27997903 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Pancreatic Ductal Adenocarcinoma (PDAC) samples and corresponding normal tissues were prospectively collected from 20 patients |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GTCATCTGTATAGTGTATGCCGTTA ReverseCAGCTGGAATGGTGATTTCTT | Statistics | Fold Change : Upregulated,5.417164 pvalue : p=0.00298 |
Citation | |||
Li, H, Hao, X, Wang, H, Liu, Z, He, Y, Pu, M, Zhang, H, Yu, H, Duan, J, Qu, S (2016). Circular RNA Expression Profile of Pancreatic Ductal Adenocarcinoma Revealed by Microarray. Cell. Physiol. Biochem., 40, 6:1334-1344. |